ALYREF-Mediated Regulation of TBL1XR1 and KMT2E Synergistically Upregulates APOC1, Contributing to Oxaliplatin Resistance in Esophageal Cancer

Jie Hu; Qilong Liu; Bi Feng; Yanling Lu; Kai Chen

doi:10.4143/crt.2024.1091

Articles

Page Path: HOME > Cancer Res Treat > Volume 57(4); 2025 > Article

Original Article Gastrointestinal cancer ALYREF-Mediated Regulation of TBL1XR1 and KMT2E Synergistically Upregulates APOC1, Contributing to Oxaliplatin Resistance in Esophageal Cancer: Jie Hu¹, Qilong Liu², Bi Feng¹, Yanling Lu¹, Kai Chen¹; Cancer Research and Treatment : Official Journal of Korean Cancer Association 2025;57(4):1064-1089.
DOI: https://doi.org/10.4143/crt.2024.1091
Published online: February 4, 2025

¹Department of Medical Oncology of The Eastern Hospital, The First Affiliated Hospital, Sun Yat-Sen University, Guangzhou, China

²Department of Gastroenterology of The Eastern Hospital, The First Affiliated Hospital, Sun Yat-Sen University, Guangzhou, China

Correspondence: Kai Chen, Department of Medical Oncology of The Eastern Hospital, The First Affiliated Hospital, Sun Yat-Sen University, No. 58, Zhong Shan Er Lu, Guangzhou 510080, China
Tel: 86-13570289193 E-mail: chenk6@mail.sysu.edu.cn

• Received: November 15, 2024 • Accepted: February 3, 2025

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

3,138 Views
126 Download
2 Web of Science
1 Crossref
2 Scopus

prev next

Full Article

Download PDF

Abstract

Purpose
Esophageal cancer (EC) is a rapidly progressing malignancy characterized by a low survival rate and limited treatment success, largely due to late-stage detection, frequent recurrence, and a high propensity for metastasis, despite ongoing advances in therapeutic strategies. While oxaliplatin (L-OHP) is a potent chemotherapeutic agent that induces apoptosis in EC cells, its effectiveness is significantly hindered by the development of resistance.
Materials and Methods
The assessment of gene and protein expression was conducted through a combination of quantitative real-time polymerase chain reaction, Western blot, and immunohistochemical staining. Cell viability was assessed using the cell counting kit-8 assay. The interactions among ALYREF, TBL1XR1, KMT2E, and APOC1 were investigated through RNA immunoprecipitation, chromatin immunoprecipitation (ChIP), ChIP-reChIP, RNA pulldown, and dual-luciferase assays. An in vivo mouse model of EC was established.
Results
Expression levels of both APOC1 and ALYREF were elevated in L-OHP–resistant EC tissues and cell lines, and their silencing enhanced sensitivity to L-OHP. TBL1XR1 and KMT2E synergistically upregulated APOC1 expression. Moreover, ALYREF recognized the 5-methylcytosine (m5C) sites on TBL1XR1 and KMT2E mRNAs, stabilizing these transcripts and promoting APOC1 expression. The regulatory role of these interactions was further validated in vivo.
Conclusion
This study demonstrated that ALYREF interacted with the m5C sites on TBL1XR1 and KMT2E mRNAs, enhancing their stability and leading to increased transcription of APOC1, which in turn contributed to L-OHP resistance in EC. These findings suggest that targeting APOC1 could be a promising strategy for overcoming L-OHP resistance in EC.
Key words: Esophageal neoplasms, Oxaliplatin resistance, ALYREF, TBL1XR1, KMT2E, H3K4me3 modification, APOC1

Introduction

Esophageal cancer (EC) ranks among the most aggressive types of cancer with a high mortality rate worldwide [1]. Despite advancements in diagnostic and therapeutic approaches, including surgery, chemotherapy, radiotherapy, and targeted therapies, outcomes for patients with EC remain generally poor [2]. This is primarily due to the disease often being detected at an advanced stage and having a high likelihood of recurrence and metastasis [2]. Among the chemotherapeutic agents, oxaliplatin (L-OHP) has been widely used as a key component in the treatment of EC due to its efficacy in inducing cancer cell apoptosis via DNA cross-linking and inhibition of DNA replication [3]. However, the development of resistance to L-OHP significantly limits its therapeutic effectiveness, posing a major challenge in the clinical management of EC [4]. Therefore, overcoming L-OHP resistance and enhancing the sensitivity of EC cells to L-OHP could be crucial strategies for improving treatment outcomes.

Apolipoprotein C1 (APOC1) plays a crucial role in the metabolism of very low-density lipoprotein and high-density lipoprotein cholesterol [5]. Recent studies suggest that APOC1 may represent a promising therapeutic target in the treatment of solid tumors [6,7]. APOC1 enhanced glioma metastasis by promoting epithelial-mesenchymal transition and the activation of the STAT3 signaling pathway [7]. Additionally, APOC1 facilitated osteosarcoma progression via regulating mitochondrial carrier homolog 2 [8]. Our preliminary data, including Gene Expression Profiling Interactive Analysis (GEPIA) predictions, indicated that APOC1 was highly expressed in EC. Recent reports showed that APOC1 was closely associated with EC, with high levels of APOC1 predicting poor prognosis and correlating with tumor immune infiltration [9]. Therefore, downregulating APOC1 may potentially improve the sensitivity of EC to L-OHP. However, whether APOC1 influences L-OHP resistance in EC remains to be examined.

The oncogene transducin β-like 1 X-linked receptor 1 (TBL1XR1) is known to be highly expressed in various tumors and is correlated with poor prognosis [10,11], indicating that TBL1XR1 plays a critical role in the progression of tumor. Predictions from the GEPIA platform also showed that TBL1XR1 was highly expressed in EC, and its elevated expression correlated with lower survival rates. Previous studies have confirmed that TBL1XR1 induced lymph node metastasis in EC [12]. Additionally, as a transcriptional activator, TBL1XR1 was predicted to bind to the promoter of APOC1, leading us to speculate that TBL1XR1 may transcriptionally activate APOC1 expression. Analysis of histone modifications at the APOC1 promoter revealed a significant enrichment of trimethylation at histone H3 lysine 4 (H3K4me3), a mark associated with active transcription [13]. Lysine methyltransferase 2E (KMT2E), also known as mixed-lineage leukemia 5 (MLL5) or SET domain-containing protein 5B, was reported in previous studies to mediate H3K4me3 modifications and function as a transcriptional activator [14]. Furthermore, KMT2E has been shown to interact with TBL1XR1, and GEPIA predictions indicate that KMT2E was highly expressed in EC. These findings led us to hypothesize that TBL1XR1 may interact with KMT2E, thereby mediating the epigenetic activation of APOC1 expression.

5-Methylcytosine (m5C) has been identified in mRNA, rRNA, and tRNA molecules across various species [15]. As a reversible epigenetic modification, m5C influences the fate of RNA molecules and plays critical roles in biological processes such as RNA stability regulation, transcriptional regulation, and protein synthesis [16]. m5C modification is primarily mediated by three types of proteins: methyltransferases (writers), demethylases (erasers), and recognition proteins (readers) [16]. Our analysis revealed the presence of m5C modifications on TBL1XR1 and KMT2E mRNAs. Additionally, predictions from GEPIA and RM2target database suggest that the recognition protein ALYREF was highly expressed in EC and can bind to the m5C sites on TBL1XR1 and KMT2E mRNA. As a recognition protein for m5C, ALYREF can regulate mRNA stability [17]. Therefore, we speculated that ALYREF may recognize the m5C sites on TBL1XR1 and KMT2E mRNA, thereby enhancing the stability of these mRNAs.

In summary, this study hypothesized that ALYREF bound to the m5C sites on TBL1XR1 and KMT2E mRNAs, which increased their stability and subsequently upregulated the expression of TBL1XR1 and KMT2E. This, in turn, transcriptionally activated APOC1 expression, thereby promoting L-OHP resistance in EC. This research aims to elucidate the molecular mechanisms underlying APOC1-mediated regulation of L-OHP resistance via the ALYREF-TBL1XR1/KMT2E axis in EC, highlighting the potential of targeting the APOC1 axis as a novel therapeutic strategy to enhance L-OHP sensitivity.

Materials and Methods

1. Clinical sample collection

Tissues from EC and corresponding adjacent normal tissues were obtained from five patients with EC, who have not received radiation or chemotherapy. Five L-OHP–resistant and five L-OHP–sensitive EC tissues were collected from EC patients, who have received L-OHP treatment.

2. Cell culture

The EC lines EC109, Kyse-30, Kyse-70, Kyse-150, TE-1, and 293T were received from American Type Culture Collection (ATCC) and grown in Dulbecco’s modified Eagle’s medium (Gibco) containing 10% fetal bovine serum (FBS), 100 units/mL of penicillin, and 100 μg/mL of streptomycin. The cells were incubated at 37°C in a humidified environment with 5% CO₂. The normal epithelial cell line Het-1A was cultured in Dulbecco’s modified Eagle’s medium/nutrient mixture F-12, supplemented with 10% FBS and 3% G418 disulfide solution, in a 5% CO₂ atmosphere at 37°C. The culture medium was refreshed every 2-3 days.

To develop L-OHP–resistant cell lines, EC109 and TE-1 cells were gradually exposed to increasing concentrations of L-OHP (0, 0.5, 1.0, 2.5, 5.0, and 10.0 μmol/L; Pharmacia). The resistant variants, designated as EC109-R and TE-1-R, were then maintained in a medium supplemented with 1.6 μg/mL of L-OHP, except when stated otherwise. Before carrying out further experiments, these cells were transferred to an L-OHP–free medium for a minimum of 1 week.

3. Cell transfection

EC109-R and TE-1-R cells were plated 24 hours before transfection. Short hairpin RNAs (shRNAs) targeting APOC1 (shAPOC1), TBL1XR1 (shTBL1XR1), KMT2E (shKMT2E), and ALYREF (shALYREF), along with a non-targeting control shRNA (shNC), were designed by Genesee Biotech and inserted into GV102 vectors by Genepharma. All above shRNA sequences were provided in Table 1. For overexpression studies, the complete coding sequences of APOC1, TBL1XR1, and KMT2E were amplified by polymerase chain reaction (PCR) and cloned into the pcDNA3.1 vector (Promega) to construct the respective overexpression plasmids. An empty vector served as the negative control (NC). These plasmids were introduced into EC109-R and TE-1-R cells (5×10⁶ cells per well) using 20 μL of Lipofectamine 3000 (Invitrogen) as the transfection reagent. The culture medium was refreshed 6 hours following transfection, and the cells were subsequently maintained in the new medium for a period of 48 hours before proceeding to subsequent in vitro assays.

In parallel experiments, 293T cells (5×10⁶ cells per well) were transfected with lentiviral vectors containing shALYREF using Lipofectamine 3000. After 48 hours, the supernatant containing the generated lentiviruses was harvested and filtered. The collected lentiviral particles were then used to infect EC109-R and TE-1-R cells (5×10⁶ cells per well). Two days post-infection, the cells underwent selection with 2.5 μg/mL puromycin for 12 days. Upon completion of the selection process, puromycin was removed, and the cells were maintained in standard culture conditions until full recovery.

4. Cell counting kit-8 assay

To assess cell proliferation in EC109-R and TE-1-R cells, the cell counting kit-8 (CCK-8) assay (ab228554, Abcam) was performed. Cells were seeded into a 96-well plate at a concentration of 5,000 cells per well and allowed to grow for 48 hours. Following this incubation period, 10 μL of CCK-8 reagent was added to each well, and the plate was incubated for another 4 hours. Subsequently, the absorbance was recorded using a microplate reader (Thermo Fisher Scientific) to determine cell viability.

5. Western blot

Protein extraction was carried out by incubating the samples in radioimmunoprecipitation assay buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate [SDS]) containing a mixture of protease inhibitors for 30 minutes at 4°C (Beyotime Inc.). The protein concentration in each sample was then quantified using a bicinchoninic acid protein assay kit (cat. No. 10741395, Thermo Fisher Scientific). For electrophoresis, 30 μg of protein from each sample was loaded onto a sodium dodecyl sulfate–polyacrylamide gel and subsequently transferred to polyvinylidene fluoride membranes. Membranes were blocked and washed with phosphate-buffered saline (PBS) before being incubated with primary antibodies against APOC1 (1:1,000, ab189866, Abcam), TBL1XR1 (1:1,000, H00079718-M01, Thermo Fisher Scientific), MLL5/KMT2E (1:500, antibodies-online, ABIN527783), ALYREF (1:1,000, H00010189-M03, Thermo Fisher Scientific), H3K4me3 (1:1,000, MA5-11199, Thermo Fisher Scientific), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:50,000, MA5-35235, Thermo Fisher Scientific). After another PBS wash, the membranes were incubated with secondary antibodies (1:2,000, cat. No. 31402, Invitrogen). The detection of the target proteins was performed using an enhanced chemiluminescence detection kit (cat. No. WBULS0100, Merck Millipore).

6. RNA extraction and quantitative real-time polymerase chain reaction

Cells were lysed to extract total RNA using Trizol reagent (Invitrogen). The isolated RNA (1 μg) was then converted to cDNA using the PrimeScript cDNA Synthesis Kit (Takara) in accordance with the provided protocol. Quantitative PCR (qPCR) was subsequently carried out with the TaqMan Universal PCR Master Mix (cat. No. 4305719, Thermo Fisher Scientific). The specific primers used for amplification are listed in Table 2. RNA expression levels were quantified using the 2^-ΔΔCt method, with GAPDH as the reference gene for normalization purposes.

7. Chromatin immunoprecipitation (ChIP) assay and reChIP assay

EC109/p, EC109-R, TE-1-R cells, or TE-1/p (4×10⁶) transfected without or with shTBL1XR1, shKMT2E, shNC, TBL1XR1 overexpression vectors, and/or KMT2E overexpression vectors were harvested and lysed with RNA immunoprecipitation (RIP) lysis buffer (Merck Millipore). The lysates underwent cross-linking and sonication to fragment the chromatin. The fragmented chromatin was mixed with ChIP dilution buffer, protease inhibitors, and Protein A Agarose/Salmon Sperm DNA beads. After incubation, the samples were centrifuged, and the supernatant was collected. The supernatant was then subjected to immunoprecipitation by overnight incubation at 4°C with either an anti-TBL1XR1 antibody (#74499, Cell Signaling Technology), anti-KMT2E antibody (#LS-C334521-20, LS Bio), anti-H3K4me3 antibodies (C15410003-50, Diagenode) or control IgG antibody (#ab205718, Abcam). Following immunoprecipitation, the samples were washed and treated with RNase A at 37°C to degrade RNA. DNA extraction was performed according to the OneDay ChIP kit protocol, followed by qPCR.

In parallel, 4×10⁶ EC109-R and TE-1-R cells transfected with shNC or shKMT2E were lysed in SDS lysis buffer, diluted with ChIP dilution buffer, and aliquoted into TPX tubes (C30010010-1000, Diagenode). The chromatin was sheared using a Bioruptor Plus and then centrifuged. The sheared chromatin was incubated with H3K4me3 antibodies (C15410003-50, Diagenode) pre-bound to DiaMag Protein A magnetic beads (C03010020-150, Diagenode) under rotation. This step was repeated with fresh beads to ensure complete binding of epitopes. Subsequently, the beads were washed thoroughly, and the chromatin was eluted using H3K4me3 antibody (ab1342, Abcam). A portion of the eluted chromatin was kept for primary ChIP, while the rest was used for reChIP with additional antibodies and beads. The chromatin was then washed, de-crosslinked, and treated with RNase A and Proteinase K to remove any remaining RNA and proteins. The purified DNA was extracted, lyophilized, and resuspended in nuclease-free water. The DNA concentration was measured with Qubit, and ChIP libraries were prepared using Diagenode MicroPlex kits (C05010010) before sequencing on the Illumina HiSeq 2500 platform.

8. Dual-luciferase reporter assay

The wild-type sequences for TBL1XR1 (TBL1XR1-wt) and KMT2E (KMT2E-wt), as well as their corresponding mutant sequences (TBL1XR1-mut and KMT2E-mut), were amplified and inserted into the psiCHECK2 vector (Promega). EC109-R and TE-1-R cells were then co-transfected with either the wild-type or mutant constructs of TBL1XR1 and KMT2E, along with shALYREF or their respective NCs, using Lipofectamine 3000 (Invitrogen) as the transfection reagent. Following a 48-hour incubation period, luciferase activity was assessed with the Dual-Luciferase Reporter Assay Kit (Promega).

To investigate the role interaction of APOC1, TBL1XR1, and KMT2E, 293T cells were transfected with TBL1XR1 overexpression vectors (TBL1XR1), KMT2E, TBL1XR1 plus KMT2E vectors using Lipofectamine 3000 (Invitrogen) as the transfection reagent. Following a 48-hour incubation period, luciferase activity was assessed with the Dual-Luciferase Reporter Assay Kit (Promega).

9. RNA stability assay

To assess RNA stability, EC109-R and TE-1-R cells transfected with shNC or shALYREF were exposed to 5 μg/mL actinomycin D (Aladdin) for varying durations (0, 4, and 8 hours). After each time point, the mRNA levels of TBL1XR1 and KMT2E were quantified using qPCR.

10. Animal studies

All animal procedures in this study were approved by the ethics committee at The First Affiliated Hospital, Sun Yat- Sen University. Seventy-two BALB/c nude mice (6-7 weeks old, 20-25 g) were obtained from Huachuang Sion and maintained in a controlled environment.

In the first set of experiments, the mice were randomly seperated six groups (6 mice per group). The groups were injected subcutaneously at the right dorsal midline with PBS, 2.5×10⁶ shNC-transfected EC109/R cells, or shALYREF-transfected EC109/R cells. Each group was further divided into two sub-groups, which were treated daily via intraperitoneal injection with either 400 μL of L-OHP (6 mg/kg) or vehicle (5% glucose) for 2 weeks. This resulted in six sub-groups: control, shNC, shALYREF, L-OHP, shNC+L-OHP, and shALYREF+L-OHP. Fourteen days after completing L-OHP treatment, the mice were sacrificed, and tumor weight and volume were measured. Tumor tissues were then collected for further analysis.

In the second set of experiments, the procedure was identical, except TE-1/R cells were used in place of EC109/R cells.

11. Immunohistochemical staining

Tumor samples from EC were fixed in 3.7% buffered formalin and later embedded in paraffin blocks. To perform immunohistochemical (IHC) staining, 5-μm-thick tissue sections were cut from the paraffin blocks. The sections were then deparaffinized, rehydrated, and subjected to antigen retrieval by heating them in a citrate buffer solution. To block endogenous peroxidase activity, the sections were treated with hydrogen peroxide. Next, the tissue sections were pre-incubated with goat serum, followed by incubation with primary antibodies targeting ALYREF (1:100, #16690-1-AP, Thermo Fisher Scientific), TBL1XR1 (1:500, #55312-1-AP, Thermo Fisher Scientific), KMT2E (1:100, #PA5-117037, Thermo Fisher Scientific), APOC1 (1:100, #PA5-145261, Thermo Fisher Scientific), TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling; using #11684795910, TUNEL staining kit, Roche, according to the manufacturer’s protocol), and Ki67 (1:100, #ab15580, Abcam) for 12 hours at 4°C. After washing with PBS, the sections were incubated with secondary antibodies at room temperature for 1 hour. Hematoxylin was used to counterstain the sections, which were then mounted and examined under a DMi8 optical microscope.

12. RNA immunoprecipitation assay

EC109-R and TE-1-R cells, transfected with either shALYREF or shNC, were prepared for an RIP assay utilizing the EZ-Magna RIP RNA-Binding Protein Immunoprecipitation Kit (No. 17-701, Merck Millipore). Cells were lysed in RIP lysis buffer, followed by sonication and centrifugation to remove debris and obtain a clear supernatant. This supernatant was then pre-treated with magnetic beads and subsequently incubated with an anti-ALYREF antibody (#MA1-26754, Thermo Fisher Scientific) or a control anti-IgG antibody (#30000-0-AP, Proteintech) at 4°C overnight. After incubation, the RNA-protein complexes were isolated using protein G Sepharose 4 Fast Flow beads (GE Amersham). To extract the bound RNA, the beads were treated with proteinase K (Sangon) for 1 hour. The RNA was then analyzed by qPCR using specific primers, as described in the quantitative real-time polymerase chain reaction protocol.

13. RNA pull-down assay

To isolate biotin-labeled RNA complexes, cell lysates from EC109-R and TE-1-R were incubated with streptavidin-coated magnetic beads, which selectively bind to biotin-tagged RNA molecules, according to the instructions provided by the manufacturer (Invitrogen). The lysates were incubated with custom biotinylated probes targeting TBL1XR1 or KMT2E (GenePharma) to allow for interaction. Following the incubation, the beads were thoroughly washed to remove nonspecific proteins. The ability of TBL1XR1 or KMT2E to pull down ALYREF was then evaluated by Western blot.

14. Bioinformatics prediction

GEPIA (http://gepia.cancer-pku.cn/) was performed to predict the expression levels of TBL1XR1, KMT2E and APOC1. hTFtarget (https://bio.tools/hTFtarget) predicted that TBL1XR1 binds to the APOC1 promoter. Cistrome DB (http://cistrome.org/) indicated that the APOC1 gene has H3K4me3 modifications. An interaction between TBL1XR1 and KMT2E was identified by Biogrid4.4 (https://wiki.thebiogrid.org/). RM2target (http://rm2target.canceromics.org/) showed that ALYREF interacts with the mRNAs of TBL1XR1 and KMT2E.

15. Gene Expression Omnibus dataset analysis

Publicly available transcriptomics datasets from the Gene Expression Omnibus (GEO) database were used to analyze APOC1 expression in EC and adjacent non-cancerous tissues. Datasets with RNA-seq data were selected, and data preprocessing steps, including normalization and log-transformation, were applied. Differential expression analysis was conducted using the limma package in R for group comparisons. Statistical significance was assessed using Student’s t test, and data visualization was performed with ggplot2 in R (R Foundation for Statistical Computing).

16. Statistical analysis

Statistical analyses were carried out using SPSS software ver. 20.0 (IBM Corp.). The data are reported as the mean±standard deviation from at least three separate experiments. To compare differences between two groups, an unpaired Student’s t test was applied, while one-way ANOVA with Tukey’s post hoc test was utilized for comparisons among multiple groups. A p-value of less than 0.05 was regarded as indicating statistical significance.

Results

1. High expression of APOC1 in oxaliplatin-resistant EC and its knockdown enhanced drug sensitivity

It was indicated by GEO database analysis results that APOC1 expression was elevated in EC (S1A Fig.). To further explore the expression patterns of APOC1 in EC, its levels were assessed in EC tissues. APOC1 was highly expressed in EC tissues (Fig. 1A). Moreover, a significant upregulation of APOC1 was observed in L-OHP–resistant EC tissues in relation to L-OHP–sensitive tissues (Fig. 1B). A similar trend was seen across various EC cell lines, including EC109, Kyse-30, Kyse-70, Kyse-150, and TE-1, where APOC1 expression was notably high (Fig. 1C). As L-OHP concentrations increased, a corresponding decrease in EC cell viability was observed (Fig. 1D). Among these cell lines, EC109 and TE-1 showed less reduction in viability and were, therefore, selected for the following experiments. L-OHP–resistant EC cell lines were established for EC109 and TE-1. Further analysis revealed that APOC1 expression was elevated in L-OHP–resistant EC109, and TE-1 cell lines compared to their parental counterparts, and these resistant cell lines exhibited higher viability than the parental cells (Fig. 1E and F). Next, APOC1 was knocked down in L-OHP–resistant EC109 and TE-1 cells. The silencing of APOC1 resulted in a significant reduction in its expression (Fig. 1G), resulting in decreased L-OHP resistance (Fig. 1H). Altogether, APOC1 was elevated in L-OHP–resistant EC, and its knockdown promoted L-OHP drug sensitivity.

2. TBL1XR1 and KMT2E transcriptionally regulated APOC1 expression

We next investigated the mechanisms underlying APOC1-mediated L-OHP sensitivity. Expression levels of TBL1XR1 and KMT2E were examined in the normal esophageal epithelial cell line, Het-1A, and several EC cell lines, including EC109, Kyse-30, Kyse-70, Kyse-150, and TE-1. Both TBL1XR1 and KMT2E expression levels were higher in EC109 and TE-1 cells compared to esophageal epithelial cells (Fig. 2A). In addition, analysis of both L-OHP–resistant and their parental EC cells revealed elevated levels of TBL1XR1 and KMT2E in the resistant cells (Fig. 2B). The binding of TBL1XR1 to the APOC1 promoter was predicted by bioinformatic tool hTFtarget (Fig. 2C). Afterward, ChIP confirmed that TBL1XR1 bound to the APOC1 promoter BS1-2 in two L-OHP–resistant EC109 and TE-1 cell lines (Fig. 2D). To further explore the role of TBL1XR1, TBL1XR1 was knocked down in L-OHP–resistant EC109 and TE-1 cell lines. Knockdown of TBL1XR1 in these resistant cells led to reduced TBL1XR1 and APOC1 expression, along with diminished binding of TBL1XR1 to the APOC1 promoter (Fig. 2E and F). To explore the chromatin landscape, Cistrome DB predictions indicated the presence of H3K4me3 modifications at the APOC1 promoter, and this was confirmed by ChIP in L-OHP–resistant EC109, and TE-1 cell lines (Fig. 2G and H). Furthermore, the enrichment of H3K4me3 at the APOC1 promoter was significantly higher in the L-OHP–resistant cell lines EC109/R and TE-1/R compared to their corresponding parental cell lines (Fig. 2H). Additionally, knockdown of KMT2E in L-OHP–resistant cell lines decreased KMT2E and APOC1 expression, reduced KMT2E binding to the APOC1 promoter, and diminished H3K4me3 enrichment at the APOC1 promoter (Fig. 2I-K). Predictions from Biogrid4.4 also suggested an interaction between TBL1XR1 and KMT2E (Fig. 2L), which was confirmed by co-immunoprecipitation, further supporting the cooperative role of TBL1XR1 and KMT2E (Fig. 2M). The interactions among TBL1XR1, KMT2E, and APOC1 were further examined. Overexpression of TBL1XR1 resulted in a significant increase in its binding enrichment at the APOC1 promoter (Fig. 2N). Overexpression of KMT2E alone also caused an increase in TBL1XR1 binding at the APOC1 promoter. However, co-overexpression of TBL1XR1 and KMT2E further enhanced the binding enrichment of TBL1XR1 at the APOC1 promoter, suggesting a synergistic interaction between the two factors. Moreover, the knockdown of TBL1XR1 in L-OHP–resistant EC109 and TE-1 cells nearly abolished KMT2E binding to the APOC1 promoter, while KMT2E knockdown significantly reduced TBL1XR1 binding, indicating that TBL1XR1 recruits KMT2E to transcriptionally regulate APOC1 (Fig. 2O and P). Overall, these results indicate that TBL1XR1 and KMT2E were enhanced in EC and L-OHP–resistant cell lines, where they co-bound to the APOC1 promoter to regulate its expression. Knockdown of either protein disrupted this regulation, highlighting their synergistic role in promoting L-OHP resistance in EC.

3. TBL1XR1 and KMT2E synergistically upregulated APOC1 expression, promoting L-OHP resistance in esophageal cancer

To further assess the impact of TBL1XR1 and KMT2E on APOC1 expression and L-OHP resistance, L-OHP–resistant EC109 and TE-1 cell lines were manipulated to knock down TBL1XR1 and/or overexpress APOC1. TBL1XR1 knockdown led to reduced expression of both TBL1XR1 and APOC1, which was associated with decreased cell viability upon L-OHP treatment (Fig. 3A and B). Conversely, overexpression of APOC1 resulted in elevated expression and enhanced cell viability in response to L-OHP. Importantly, APOC1 overexpression mitigated the effects of TBL1XR1 knockdown on APOC1 levels and cell viability. In parallel experiments, L-OHP–resistant EC109 and TE-1 cell lines were subjected to KMT2E knockdown and/or APOC1 overexpression. KMT2E knockdown similarly reduced KMT2E and APOC1 expression, accompanied by a decline in cell viability following L-OHP treatment (Fig. 3C and D). APOC1 overexpression, however, elevated APOC1 expression and L-OHP–resistant EC cell viability in response to L-OHP treatment. Furthermore, APOC1 overexpression attenuated the effects of KMT2E knockdown on APOC1 expression and cell viability. Taken together, TBL1XR1 and KMT2E synergistically induced APOC1 expression, thereby enhancing L-OHP resistance in EC cells.

4. ALYREF was highly expressed in L-OHP–resistant EC tissues and cells, and its knockdown increased the sensitivity of EC to L-OHP

To determine the role of ALYREF in L-OHP resistance in EC, ALYREF expression levels were evaluated in EC tissues and adjacent normal tissues. ALYREF expression was significantly higher in EC tissues compared to the adjacent normal tissues (Fig. 4A). Moreover, L-OHP–resistant EC tissues exhibited higher ALYREF expression than L-OHP–sensitive tissues (Fig. 4B). In cell line analyses, ALYREF was highly expressed in EC cells (EC109 and TE-1) in comparison to normal esophageal epithelial cells (Het-1A) (Fig. 4C). In L-OHP–resistant cell lines and their parental counterparts, ALYREF expression was elevated in the resistant cells (Fig. 4D). To determine the effect of ALYREF knockdown on L-OHP resistance, ALYREF was knocked down in L-OHP–resistant EC109 and TE-1 cell lines. The silencing of ALYREF decreased ALYREF expression levels in L-OHP–resistant EC109 and TE-1 cells and reduced cell viability following L-OHP treatment (Fig. 4E and F). These findings suggest that ALYREF contributes to L-OHP resistance in EC.

5. ALYREF regulated the levels of TBL1XR1 and KMT2E through m5C modification

To investigate the binding of ALYREF with TBL1XR1 and KMT2E mRNA, RM2target predictions were conducted. The results indicated a potential interaction between ALYREF and both TBL1XR1 and KMT2E mRNA (Fig. 5A and B). This was further confirmed by dual-luciferase reporter assays, where knockdown of ALYREF in TBL1XR1-wt or KMT2E-wt L-OHP–resistant EC109 and TE-1 cells reduced its binding to the m5C sites on TBL1XR1 and KMT2E mRNA (Fig. 5C and D). In contrast, ALYREF depletion in TBL1XR1-mut or KMT2E-mut cells did not induce any changes in the binding of ALYREF to the m5C sites on TBL1XR1 and KMT2E mRNA, respectively. Furthermore, TBL1XR1 and KMT2E were significantly enriched in the L-OHP–resistant EC109, and TE-1 cell complexes incubated with anti-ALYREF antibody, but not with anti-IgG antibody (Fig. 5E and F). However, these enrichments of TBL1XR1 and KMT2E were attenuated upon ALYREF knockdown. The RNA pulldown assay further confirmed the interaction of ALYREF with TBL1XR1 and KMT2E (Fig. 5G and H). Actinomycin D treatment induced a time-dependent degradation of TBL1XR1 and KMT2E mRNA in L-OHP–resistant EC109 and TE-1 cells (Fig. 5I and J). This degradation was further increased after the knockdown of ALYREF, suggesting that ALYREF plays a key role in maintaining the stability of these transcripts. Collectively, ALYREF was found to bind to TBL1XR1 and KMT2E mRNA, with m5C sites being crucial for this interaction, and its knockdown led to the destabilization of these mRNAs, highlighting its potential regulatory function in L-OHP–resistant cells.

6. ALYREF promoted APOC1 expression through TBL1XR1/KMT2E, thereby enhancing L-OHP resistance in esophageal cancer

To validate the regulatory role of ALYREF in L-OHP resistance in EC, ALYREF was knocked down, and TBL1XR1 or KMT2E was overexpressed in L-OHP–resistant cells. ALYREF knockdown significantly reduced the expression levels of ALYREF, APOC1, TBL1XR1 and KMT2E, and decreased the viability of L-OHP–resistant EC109 and TE-1 cells after L-OHP treatment (Fig. 6A-D). Conversely, overexpression of TBL1XR1 or KMT2E led to increased expression of APOC1 and TBL1XR1 or KMT2E, respectively, as well as enhanced cell viability following L-OHP treatment. Notably, TBL1XR1 or KMT2E overexpression reversed the effects of ALYREF knockdown on TBL1XR1 or KMT2E and APOC1 expression, as well as on cell viability. Furthermore, APOC1 depletion resulted in a decreased expression of APOC1, while the expression levels of ALYREF, TBL1XR1, and KMT2E remained unchanged (S1 Fig.). Collectively, these results indicate that ALYREF enhanced APOC1 expression through TBL1XR1/KMT2E axis, thereby inducing L-OHP resistance in EC.

7. ALYREF-induced APOC1-mediated L-OHP resistance in EC via TBL1XR1/KMT2E in vivo

Finally, to assess the impact of ALYREF knockdown on tumor growth in vivo, ALYREF-depleted L-OHP–resistant EC109 or TE-1 cells were subcutaneously injected into nude mice, followed by daily L-OHP injections for 14 consecutive days. Knockdown of ALYREF or treatment with L-OHP alone led to a reduction in tumor size, volume, and weight (Fig. 7A-C). The combination of ALYREF knockdown and L-OHP treatment resulted in a further decrease in tumor size, volume, and weight compared to either treatment alone, suggesting that ALYREF knockdown and L-OHP treatment exert a synergistic effect on EC tumor suppression. IHC analysis showed that ALYREF, TBL1XR1, KMT2E, and APOC1 expression levels were reduced following either ALYREF knockdown or L-OHP treatment (Fig. 7D). Furthermore, the combination of ALYREF knockdown and L-OHP treatment led to a more pronounced reduction in these protein expression levels. We also observed that in the shALYREF group, there is an increase in apoptosis, as evidenced by a higher number of TUNEL-positive cells, and a decrease in proliferation, indicated by fewer Ki67-positive cells (Fig. 7D). These effects were further enhanced upon L-OHP treatment, with a more pronounced increase in apoptosis and a greater reduction in proliferation. In summary, ALYREF knockdown suppresses APOC1-induced L-OHP resistance by regulating TBL1XR1 and KMT2E expression in vivo.

Discussion

EC remains a highly aggressive malignancy with a poor prognosis due to late-stage diagnosis, recurrence, and metastasis, despite advancements in treatment [2]. Although L-OHP is an effective chemotherapeutic agent for inducing cancer cell apoptosis in EC, resistance to L-OHP limits its clinical efficacy [18]. Therefore, uncovering the mechanisms underlying L-OHP resistance may help develop new drugs to overcome this challenge. This study demonstrated that APOC1 and ALYREF were highly expressed in L-OHP–resistant EC tissues and cells, and knockdown of APOC1 or ALYREF enhanced L-OHP sensitivity in EC. We also revealed that TBL1XR1 and KMT2E synergistically upregulated APOC1 expression. In addition, we showed that ALYREF recognized the m5C sites on TBL1XR1 and KMT2E mRNAs, enhancing their stability and promoting APOC1 expression. Finally, we validated this regulatory axis in vivo. These findings may provide insights into using APOC1 as a therapeutic target for overcoming L-OHP resistance in EC.

APOC1, a pro-transfer factor, plays a significant role in cancer progression, metastasis, and drug resistance [9]. For instance, in clear cell renal cell carcinoma, APOC1 upregulation was correlated to disease advancement [19]. APOC1 promoted metastasis in clear cell renal cell carcinoma by facilitating epithelial-mesenchymal transition (EMT), while its suppression inhibited EMT [19]. Similarly, research by Guo et al. [9] demonstrated that APOC1 was highly expressed in EC tissues, where its increased expression contributed to EC progression and was associated with poor prognosis and changed immune microenvironment. Another study further supported that APOC1 served as a marker of poor prognosis in EC and was related to tumor immune infiltration during cancer development [20]. Consistently, our study showed that APOC1 was abnormally increased in EC tissues, and we found that knockdown of APOC1 enhanced L-OHP sensitivity in EC cells. This finding aligns with the study by Hu et al. [21], which documented that silencing APOC1 attenuated sorafenib resistance by inducing ferroptosis in EC. However, to the best of our knowledge, our study is the first to suggest that APOC1 is directly involved in regulating L-OHP resistance in EC.

TBL1XR1 has been associated with the progression of multiple human cancers and is recognized as a potential biomarker for poor prognosis and tumor development across different cancer types [11]. In the context of EC, TBL1XR1 expression was markedly elevated in tumor tissues, with this increased expression significantly correlated with advanced disease stages and reduced patient survival [12]. TBL1XR1 is considered an independent prognostic factor for EC, having been shown to enhance lymphangiogenesis and facilitate lymphatic metastasis in this cancer type [12]. Moreover, TBL1XR1 has been involved in the modulation of drug resistance; for example, Wu et al. [22] demonstrated that the plasmacytoma variant translocation 1 modulated cisplatin resistance through the miR-3619-5p/TBL1XR1 axis in gastric cancer. However, the role of TBL1XR1 in regulating resistance to L-OHP in EC has not been previously established. Similar to TBL1XR1, KMT2E, a member of the KMT2 family, has been implicated in various cancers [23]. Previous studies have indicated that KMT2E was highly expressed among 60 human tumor cell lines and was associated with diverse prognostic outcomes in cancer, predicting poor prognosis in kidney chromophobe carcinoma but favorable survival outcomes in acute myeloid leukemia, skin cutaneous melanoma, lung adenocarcinoma, and kidney renal clear cell carcinoma [23]. Additionally, KMT2E has been linked to increased resistance to fluorouracil [23]. In our current study, we expanded the understanding of the roles of TBL1XR1 and KMT2E in EC. Our findings demonstrated that both TBL1XR1 and KMT2E were highly expressed in EC tumor cells and L-OHP–resistant EC cell lines. We further showed that TBL1XR1 recruited KMT2E to transcriptionally regulate the expression of APOC1. Moreover, TBL1XR1 and KMT2E synergistically upregulated APOC1 expression, thereby promoting resistance to L-OHP in EC. These findings highlighted the critical regulatory role of TBL1XR1 and KMT2E in APOC1-mediated L-OHP resistance in EC.

m5C methylation is a key epigenetic modification found in nearly all RNA types [24]. This modification is regulated by various enzymes, including m5C methyltransferases from the NOP2/Sun RNA methyltransferase family, the DNA methyltransferase family, and the tRNA aspartic acid methyltransferase family, as well as demethylases from the ten-eleven translocation family and alpha-ketoglutarate-dependent dioxygenase AlkB homolog 1 [16]. Additionally, ALYREF, RNA-binding proteins such as YTH N6-methyladenosine RNA binding protein 2, and Y-box binding protein 1 (YBX1) play crucial roles in the regulation of m5C modification [25]. Among these, ALYREF has been linked to several malignant traits, including increased cell proliferation, tumor heterogeneity, metastasis, and resistance to cell death [26]. ALYREF influences various regulatory processes, such as precursor mRNA (pre-mRNA) processing, mRNA stability, and nuclear-cytoplasmic transport [27]. In cancer, ALYREF exhibits a complex regulatory mechanism and dual roles. On one hand, previous studies have documented its role in facilitating tumor growth by enhancing cell cycle progression and reducing apoptotic activity [26,28,29]. For instance, ALYREF knockdown has been shown to cause cell cycle arrest and increased apoptosis in hepatocellular carcinoma cells [28]. Similarly, studies in breast cancer have reported that ALYREF enhances cancer cell proliferation and reduces apoptosis [29]. Furthermore, dysregulation of ALYREF is associated with poor treatment outcomes and drug resistance in cancer [25]. For example, increased levels of ALYREF and YBX1 are correlated with resistance to several chemotherapeutic agents, including fenretinide, melphalan, XL-147 (pictilisib), and fludarabine [30]. These findings highlight the oncogenic role of ALYREF in cancer. However, on the other hand, ALYREF has also been linked to increased sensitivity to certain chemotherapies, such as ARRY162 [30], floxuridine, 5-fluorodeoxyuridine, nelarabine, irinotecan, thiotepa, triethylenemelamine, and LMP-400 [31]. Furthermore, inhibition of DDX39B promoted the sensitivity of ovarian cancer cells to chemotherapy via reducing the stability of BRCA1 [32]. The dual role of ALYREF in different cancer may be attributed to its context-dependent functions, which are influenced by factors such as the cancer type, genetic mutations, tumor microenvironment, and specific regulatory pathways active in different tumors. In our study, we discovered that ALYREF enhanced the stability of TBL1XR1 and KMT2E mRNAs by binding to m5C sites, resulting in increased expression of APOC1 and greater resistance to L-OHP in EC. Furthermore, ALYREF depletion significantly increased apoptosis and decreased proliferation in EC cells, effects that were further amplified upon L-OHP treatment. It was noted that EC tumor weight was significantly reduced in ALYREF-depletion mice, even in the absence of L-OHP treatment, suggesting that ALYREF plays a crucial role in promoting both EC progression and L-OHP resistance.

In summary, this study demonstrated that ALYREF binds to m5C sites on TBL1XR1 and KMT2E mRNAs, increasing their stability, which in turn activates APOC1 transcription and promotes L-OHP resistance in EC. These findings suggest that ALYREF and APOC1 could be potential therapeutic targets for overcoming L-OHP resistance in EC. Specifically, ALYREF’s upstream regulatory role and broader involvement in critical pathways make it potentially a more comprehensive therapeutic target. By modulating ALYREF, it may be possible to simultaneously influence apoptosis, proliferation, and multiple chemoresistance mechanisms. Future studies are warranted to explore the therapeutic potential of targeting ALYREF in overcoming chemoresistance in EC and other cancers.

This study also has several limitations. First, the study did not consider the impact of tumor microenvironment factors, such as immune cell infiltration or stromal interactions, which could also influence L-OHP resistance. These factors may play a critical role in the development of chemoresistance and should be included in future research to provide a more comprehensive understanding. Additionally, while the in vivo validation supports the proposed regulatory axis, more comprehensive animal studies, and clinical trials are needed to confirm these findings in patient populations. Future research should focus on exploring other potential regulatory factors involved in L-OHP resistance and developing combination therapies targeting ALYREF and APOC1 to enhance treatment efficacy in EC.

Electronic Supplementary Material

Supplementary materials are available at Cancer Research and Treatment website (https://www.e-crt.org).

crt-2024-1091_S1_Fig.pdf

NOTES

Ethical Statement

Prior to participation in the study, each patient provided written informed consent. The study was proved by the ethics committee at The First Affiliated Hospital, Sun Yat-Sen University. All animal procedures in this study were approved by the ethics committee at The First Affiliated Hospital, Sun Yat-Sen University.

Author Contributions

Conceived and designed the analysis: Hu J, Liu Q.

Collected the data: Hu J, Feng B.

Contributed data or analysis tools: Liu Q, Lu Y, Chen K.

Performed the analysis: Hu J, Feng B, Chen K.

Wrote the paper: Hu J, Liu Q, Lu Y.

Conflicts of Interest

Conflict of interest relevant to this article was not reported.

Fig. 1.

High expression of apolipoprotein C1 (APOC1) in oxaliplatin-resistant esophageal cancer and its knockdown enhanced drug sensitivity. (A) APOC1 expression was analyzed by Western blot in esophageal cancer (EC) tissues and adjacent normal tissues (n=5). (B) APOC1 expression was detected by Western blot in oxaliplatin (L-OHP)–resistant and L-OHP–sensitive EC tissues (n=5). (C) APOC1 expression was assessed by Western blot in normal esophageal epithelial cells (Het-1A) and EC cell lines (EC109, Kyse-30, Kyse-70, Kyse- 150, TE-1). (D) Cell viability was evaluated using a cell counting kit-8 (CCK-8) assay in EC cell lines after treatment with varying concentrations of L-OHP (0, 0.5, 1.0, 2.5, 5.0, and 10.0 μmol/L) for 48 hours to identify relatively L-OHP–resistant cell lines (2 lines were selected). *p < 0.05, **p < 0.01, and ***p < 0.001 for comparisons of EC109 vs. Kyse-30, Kyse-70, and Kyse-150, respectively; ^##p < 0.01 and ^###p < 0.001 for comparisons of TE-1 vs. Kyse-30, Kyse-70, and Kyse-150, respectively. (E) APOC1 expression was examined by Western blot in L-OHP–resistant EC109 and TE-1 cells and their parental counterparts. (F) Cell viability was measured using a CCK-8 assay in L-OHP–resistant EC109 and TE-1 cells and their parental counterparts after 48 hours of L-OHP treatment. (G) APOC1 expression was analyzed by Western blot in L-OHP–resistant EC109 and TE-1 cells with APOC1 knockdown (non-targeting control shRNA [shNC], shAPOC1). (H) Cell viability was determined using a CCK-8 assay in L-OHP–resistant EC109 and TE-1 cells with APOC1 knockdown (shNC, shAPOC1) after 48 hours of L-OHP treatment. Data are presented as mean±standard deviation. Unless specified otherwise, n=3. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 2.

Transducin β-like 1 X-linked receptor 1 (TBL1XR1) and lysine methyltransferase 2E (KMT2E) transcriptionally regulated apolipoprotein C1 (APOC1) expression. (A) TBL1XR1 and KMT2E expression levels were assessed by Western blot in normal esophageal epithelial cells (Het-1A) and esophageal cancer (EC) cell lines (EC109, Kyse-30, Kyse-70, Kyse-150, TE-1). (B) TBL1XR1 and KMT2E expression levels were detected by Western blot in oxaliplatin (L-OHP)–resistant EC109 and TE-1 cells and their parental counterparts. (C) TBL1XR1 binding to the APOC1 promoter was predicted using hTFtarget. (D) TBL1XR1 binding to the APOC1 promoter was examined by chromatin immunoprecipitation (ChIP) assay in L-OHP–resistant EC109 and TE-1 cells. (E) TBL1XR1 and APOC1 expression levels were analyzed by Western blot in L-OHP–resistant EC109 and TE-1 cells with TBL1XR1 knockdown (non-targeting control shRNA [shNC], shTBL1XR1). (F) The binding of TBL1XR1 to the APOC1 promoter was evaluated by ChIP assay in L-OHP–resistant EC109 and TE-1 cells. (G) H3K4me3 modification at the APOC1 promoter was predicted using Cistrome DB. (H) H3K4me3 binding to the APOC1 promoter was detected by ChIP assay in L-OHP–resistant EC109 and TE-1 cells as well as their parent cells, EC109/p and TE-1/p. (I) KMT2E and APOC1 expression levels were determined by Western blot in L-OHP–resistant EC109 and TE-1 cells with KMT2E knockdown (shNC, shKMT2E). (J) KMT2E binding to the APOC1 promoter was assessed by ChIP assay in L-OHP–resistant EC109 and TE-1 cells. (K) KMT2E recruitment of H3K4me3 at the APOC1 promoter was investigated by ChIP-reChIP assay in L-OHP–resistant EC109 and TE-1 cells. (L) The interaction between TBL1XR1 and KMT2E was predicted using Biogrid4.4. (M) The interaction between TBL1XR1 and KMT2E was examined by co-immunoprecipitation assay in L-OHP–resistant EC109 and TE-1 cells. (N) The binding of TBL1XR1 and/or KMT2E to the APOC1 promoter was evaluated by ChIP in L-OHP–resistant EC109 and TE-1 cells. (O) KMT2E binding to the APOC1 promoter was detected by ChIP assay in L-OHP–resistant EC109 and TE-1 cells with TBL1XR1 knockdown (shNC, shTBL1XR1). (P) TBL1XR1 binding to the APOC1 promoter was detected by ChIP assay in L-OHP–resistant EC109 and TE-1 cells with KMT2E knockdown (shNC, shKMT2E). Data are presented as mean±standard deviation. n=3. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 3.

Transducin β-like 1 X-linked receptor 1 (TBL1XR1) and lysine methyltransferase 2E (KMT2E) synergistically upregulated apolipoprotein C1 (APOC1) expression, promoting oxaliplatin (L-OHP) resistance in esophageal cancer. TBL1XR1 was knocked down and/or APOC1 was overexpressed in L-OHP–resistant EC109 and TE-1 cells. (A) TBL1XR1 and APOC1 expression levels were examined by Western blot. (B) Cell viability was assessed by cell counting kit-8 (CCK-8) assay following 48 hours of L-OHP treatment. KMT2E was knocked down and/or APOC1 was overexpressed in L-OHP–resistant EC109 and TE-1 cells. (C) Western blot analysis was performed to measure the expression levels of KMT2E and APOC1. (D) Cell viability was assessed using a CCK-8 assay after 48 hours of L-OHP treatment. Data are presented as mean±standard deviation (n=3). *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 4.

Aly/REF export factor (ALYREF) was highly expressed in oxaliplatin (L-OHP)–resistant esophageal cancer tissues and cells, and its knockdown increased the sensitivity of esophageal cancer to L-OHP. (A) ALYREF expression levels were analyzed by Western blot in esophageal cancer (EC) tissues and adjacent normal tissues (n=5). (B) ALYREF expression levels were detected by Western blot in L-OHP–resistant and L-OHP–sensitive EC tissues (n=5). (C) ALYREF expression levels were assessed by Western blot in normal esophageal epithelial cells (Het-1A) and EC cell lines (EC109, Kyse-30, Kyse-70, Kyse-150, TE-1). (D) ALYREF expression levels were examined by Western blot in L-OHP–resistant EC109 and TE-1 cells and their parental counterparts. (E) ALYREF expression levels were analyzed by Western blot in L-OHP–resistant EC109 and TE-1 cells with ALYREF knockdown (non-targeting control shRNA [shNC], shALYREF). (F) Cell viability was assessed using a a cell counting kit-8 assay in L-OHP–resistant EC109 and TE-1 cells with ALYREF knockdown (shNC, shALYREF) after treatment with L-OHP (10.0 μmol/L) for 48 hours. Data are presented as mean±standard deviation. Unless specified otherwise, n=3. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 5.

Aly/REF export factor (ALYREF) regulated the levels of transducin β-like 1 X-linked receptor 1 (TBL1XR1) and lysine methyltransferase 2E (KMT2E) through 5-methylcytosine (m5C) modification. Predicted binding of ALYREF to TBL1XR1 (A) and KMT2E (B) mRNA using RM2target. The binding of ALYREF to m5C sites on TBL1XR1 (C) and KMT2E (D) mRNA was assessed by dual-luciferase reporter assays in oxaliplatin (L-OHP)–resistant esophageal cancer (EC) cells with ALYREF knockdown (non-targeting control shRNA [shNC], shALYREF). Interaction of ALYREF with TBL1XR1 (E) and KMT2E (F) mRNA was detected using RNA immunoprecipitation assays in L-OHP–resistant EC cells with ALYREF knockdown (shNC, shALYREF). The binding of ALYREF to TBL1XR1 (G) and KMT2E (H) mRNA was further validated by RNA pulldown assays in L-OHP–resistant EC cells with ALYREF knockdown (shNC, shALYREF). FL, full-length; LY, cell lysate; NC, negative control (beads only). mRNA decay rates of TBL1XR1 (I) and KMT2E (J) were measured by quantitative real-time polymerase chain reaction in L-OHP–resistant EC cells with ALYREF knockdown (shNC, shALYREF) after treatment with actinomycin D. Data are presented as mean±standard deviation (n=3). *p < 0.05, **p < 0.01.

Fig. 6.

Aly/REF export factor (ALYREF) promoted apolipoprotein C1 (APOC1) expression through transducin β-like 1 X-linked receptor 1 (TBL1XR1)/lysine methyltransferase 2E (KMT2E), thereby enhancing oxaliplatin (L-OHP) resistance in esophageal cancer. ALYREF was knocked down and/or TBL1XR1 was overexpressed in L-OHP–resistant EC109 and TE-1 cells. (A) ALYREF, TBL1XR1, and APOC1 expression levels were examined by Western blot. (B) Cell viability was assessed by a cell counting kit-8 (CCK-8) assay following 48 hours of L-OHP treatment. ALYREF was knocked down and/or KMT2E was overexpressed in L-OHP–resistant EC109 and TE-1 cells. (C) Western blot analysis was performed to measure the expression levels of ALYREF, KMT2E, and APOC1. (D) Cell viability was assessed using a CCK-8 assay after 48 hours of L-OHP treatment. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 7.

Aly/REF export factor (ALYREF)–induced apolipoprotein C1 (APOC1)–mediated oxaliplatin (L-OHP) resistance in esophageal cancer via transducin β-like 1 X-linked receptor 1 (TBL1XR1)/lysine methyltransferase 2E (KMT2E) in vivo. L-OHP–resistant EC109 and TE-1 cells with ALYREF knockdown were subcutaneously injected into nude mice, followed by daily injections of oxaliplatin for 14 days. Tumor size (A), volume (B), and weight (C) were measured to assess tumor growth. (D) Expression levels of ALYREF, TBL1XR1, KMT2E, APOC1, and Ki67, as well as apoptosis assessed by TUNEL (termial deoxynucleotidyl transferase dUTP nick end labeling) were analyzed by immunohistochemistry in the tumor tissues of each group. Scale bars=50 μm. Data are presented as mean±standard deviation (n=6). *p < 0.05, **p < 0.01, ***p < 0.001.

Table 1.

The shRNA sequences were provided in the manuscript

Gene name	Sense sequence (5’-3’)	Anti-sense sequence (5’-3’)
ALYREF	AATTGCGTGGAGACAGGTGGGAAACTTCAAGAG-agtttcccacctgtctccacgTTTTTT	GATCAAAAAACGTGGAGACAGGTGGGAAACTCTCTTGA-agtttcccacctgtctccacgC
TBL1XR1	AATTGCCAGGGACTAATAATCCAAATTCAAGAG-atttggattattagtccctggTTTTTT	GATCAAAAAACCAGGGACTAATAATCCAAATCTCTTGA-atttggattattagtccctggC
KMT2E	AATTGGCTGTTCCCTTCCAGATTTAATCAAGAG-ttaaatctggaagggaacagcTTTTTT	GATCAAAAAAGCTGTTCCCTTCCAGATTTAACTCTTGA-ttaaatctggaagggaacagcC
APOC1	AATTGGACATTTCAGAAAGTGAAGGATCAAGAG-tccttcactttctgaaatgtcTTTTTT	GATCAAAAAAGACATTTCAGAAAGTGAAGGACTCTTGA tccttcactttctgaaatgtcC

Table 2.

Primers used for RT-qPCR

Gene name	Forward sequence (5’-3’)	Reverse sequence (5’-3’)
TBL1XR1	GAGAACAGCACCAGTGGCTCTA	CCATCATAGGAACCAGTTGCTAG
KMT2E	CACAGATTGTCAGTGATGCTGAAG	CTGCTGTCCAATGTGAGTCCTAC
APOC1	AGGACAAGGCTCGGGAACTCAT	GATGTCACCCTTCAGGTCCTCA
GAPDH	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA

RT-qPCR, quantitative real-time polymerase chain reaction.

REFERENCES

1. Domper Arnal MJ, Ferrandez Arenas A, Lanas Arbeloa A. Esophageal cancer: risk factors, screening and endoscopic treatment in Western and Eastern countries. World J Gastroenterol. 2015;21:7933–43. Article PubMed PMC
2. Acharya R, Mahapatra A, Verma HK, Bhaskar L. Unveiling therapeutic targets for esophageal cancer: a comprehensive review. Curr Oncol. 2023;30:9542–68. Article PubMed PMC
3. van Meerten E, Eskens FA, van Gameren EC, Doorn L, van der Gaast A. First-line treatment with oxaliplatin and capecitabine in patients with advanced or metastatic oesophageal cancer: a phase II study. Br J Cancer. 2007;96:1348–52. Article PubMed PMC PDF
4. Martinez-Balibrea E, Martinez-Cardus A, Gines A, Ruiz de Porras V, Moutinho C, Layos L, et al. Tumor-related molecular mechanisms of oxaliplatin resistance. Mol Cancer Ther. 2015;14:1767–76. Article PubMed PDF
5. Rouland A, Masson D, Lagrost L, Verges B, Gautier T, Bouillet B. Role of apolipoprotein C1 in lipoprotein metabolism, atherosclerosis and diabetes: a systematic review. Cardiovasc Diabetol. 2022;21:272.Article PubMed PMC PDF
6. Shi X, Wang J, Dai S, Qin L, Zhou J, Chen Y. Apolipoprotein C1 (APOC1): a novel diagnostic and prognostic biomarker for cervical cancer. Onco Targets Ther. 2020;13:12881–91. PubMed PMC
7. Liang R, Zhang G, Xu W, Liu W, Tang Y. ApoC1 promotes glioma metastasis by enhancing epithelial-mesenchymal transition and activating the STAT3 pathway. Neurol Res. 2023;45:268–75. Article PubMed
8. Li R, He H, He X. APOC1 promotes the progression of osteosarcoma by binding to MTCH2. Exp Ther Med. 2023;25:163.Article PubMed PMC
9. Guo Q, Liu XL, Jiang N, Zhang WJ, Guo SW, Yang H, et al. Decreased APOC1 expression inhibited cancer progression and was associated with better prognosis and immune microenvironment in esophageal cancer. Am J Cancer Res. 2022;12:4904–29. PubMed PMC
10. Zhou Q, Wang X, Yu Z, Wu X, Chen X, Li J, et al. Transducin (beta)-like 1 X-linked receptor 1 promotes gastric cancer progression via the ERK1/2 pathway. Oncogene. 2017;36:1873–86. Article PubMed PMC PDF
11. Du R, Li K, Guo K, Chen Z, Zhao X, Han L, et al. Two decades of a protooncogene TBL1XR1: from a transcription modulator to cancer therapeutic target. Front Oncol. 2024;14:1309687.Article PubMed PMC
12. Liu L, Lin C, Liang W, Wu S, Liu A, Wu J, et al. TBL1XR1 promotes lymphangiogenesis and lymphatic metastasis in esophageal squamous cell carcinoma. Gut. 2015;64:26–36. Article PubMed
13. Park S, Kim GW, Kwon SH, Lee JS. Broad domains of histone H3 lysine 4 trimethylation in transcriptional regulation and disease. FEBS J. 2020;287:2891–902. Article PubMed PDF
14. Bochynska A, Luscher-Firzlaff J, Luscher B. Modes of interaction of KMT2 histone H3 lysine 4 methyltransferase/COMPASS complexes with chromatin. Cells. 2018;7:17.Article PubMed PMC
15. Gao Y, Fang J. RNA 5-methylcytosine modification and its emerging role as an epitranscriptomic mark. RNA Biol. 2021;18:117–27. Article PubMed PMC
16. Song H, Zhang J, Liu B, Xu J, Cai B, Yang H, et al. Biological roles of RNA m(5)C modification and its implications in cancer immunotherapy. Biomark Res. 2022;10:15.Article PubMed PMC PDF
17. Yang X, Yang Y, Sun BF, Chen YS, Xu JW, Lai WY, et al. 5-methylcytosine promotes mRNA export: NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017;27:606–25. Article PubMed PMC PDF
18. Ngan CY, Yamamoto H, Takagi A, Fujie Y, Takemasa I, Ikeda M, et al. Oxaliplatin induces mitotic catastrophe and apoptosis in esophageal cancer cells. Cancer Sci. 2008;99:129–39. Article PubMed PMC
19. Li YL, Wu LW, Zeng LH, Zhang ZY, Wang W, Zhang C, et al. ApoC1 promotes the metastasis of clear cell renal cell carcinoma via activation of STAT3. Oncogene. 2020;39:6203–17. Article PubMed PDF
20. Cao X, Wu B, Guo S, Zhong W, Zhu S, Zhang Z, et al. APOC1 predicts a worse prognosis for esophageal squamous cell carcinoma and is associated with tumor immune infiltration during tumorigenesis. Pathol Oncol Res. 2023;29:1610976.Article PubMed PMC
21. Hu J, Hu H, Liu QL, Feng B, Lu YL, Chen K. Inhibition of Apoc1 reverses resistance of sorafenib by promoting ferroptosis in esophageal cancers. Gene. 2024;892:147874.Article PubMed
22. Wu C, Hu Y, Ning Y, Zhao A, Zhang G, Yan L. Long noncoding RNA plasmacytoma variant translocation 1 regulates cisplatin resistance via miR-3619-5p/TBL1XR1 axis in gastric cancer. Cancer Biother Radiopharm. 2020;35:741–52. Article PubMed
23. Zhu J, Liu Z, Liang X, Wang L, Wu D, Mao W, et al. A pan-cancer study of KMT2 family as therapeutic targets in cancer. J Oncol. 2022;2022:3982226.Article PubMed PMC PDF
24. Chen YS, Yang WL, Zhao YL, Yang YG. Dynamic transcriptomic m(5)C and its regulatory role in RNA processing. Wiley Interdiscip Rev RNA. 2021;12:e1639PubMed
25. Zhang Q, Liu F, Chen W, Miao H, Liang H, Liao Z, et al. The role of RNA m(5)C modification in cancer metastasis. Int J Biol Sci. 2021;17:3369–80. Article PubMed PMC
26. Zhao Y, Xing C, Peng H. ALYREF (Aly/REF export factor): A potential biomarker for predicting cancer occurrence and therapeutic efficacy. Life Sci. 2024;338:122372.Article PubMed
27. Shi M, Zhang H, Wu X, He Z, Wang L, Yin S, et al. ALYREF mainly binds to the 5’ and the 3’ regions of the mRNA in vivo. Nucleic Acids Res. 2017;45:9640–53. Article PubMed PMC
28. Xue C, Gu X, Zheng Q, Shi Q, Yuan X, Su Y, et al. ALYREF mediates RNA m(5)C modification to promote hepatocellular carcinoma progression. Signal Transduct Target Ther. 2023;8:130.Article PubMed PMC PDF
29. Jeong SJ, Oh JH, Cho JY. ALYREF enhances breast cancer progression by regulating EZH2. Heliyon. 2024;10:e37749Article PubMed PMC
30. Xu R, Wang Y, Kuang Y. Multi-omic analyses of m5C readers reveal their characteristics and immunotherapeutic proficiency. Sci Rep. 2024;14:1651.Article PubMed PMC PDF
31. Ma Y, Yang J, Ji T, Wen F. Identification of a novel m5C/m6A-related gene signature for predicting prognosis and immunotherapy efficacy in lung adenocarcinoma. Front Genet. 2022;13:990623.Article PubMed PMC
32. Xu Z, Li X, Li H, Nie C, Liu W, Li S, et al. Suppression of DDX39B sensitizes ovarian cancer cells to DNA-damaging chemotherapeutic agents via destabilizing BRCA1 mRNA. Oncogene. 2020;39:7051–62. Article PubMed PDF

Figure & Data

REFERENCES

Citations

Citations to this article as recorded by

RNA m5C methylation in cancer: mechanisms and biological impact
Zhenyu Guan, Wendong Li, Yuting He, Wenzhi Guo
Oncogenesis.2025;[Epub] CrossRef

PubReader
ePub Link

Cite

CITE: export Copy Download Format; Close

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

RIS — For EndNote, ProCite, RefWorks, and most other reference management software
BibTeX — For JabRef, BibDesk, and other BibTeX-specific software

Include:

Citation for the content below
Citation and abstract for the content below

ALYREF-Mediated Regulation of TBL1XR1 and KMT2E Synergistically Upregulates APOC1, Contributing to Oxaliplatin Resistance in Esophageal Cancer

Cancer Res Treat. 2025;57(4):1064-1089. Published online February 4, 2025

DOI: https://doi.org/10.4143/crt.2024.1091

XML Download

Abstract
Introduction
Materials and Methods
Results
Discussion
Electronic Supplementary Material
NOTES
REFERENCES

ALYREF-Mediated Regulation of TBL1XR1 and KMT2E Synergistically Upregulates APOC1, Contributing to Oxaliplatin Resistance in Esophageal Cancer

Fig. 1. High expression of apolipoprotein C1 (APOC1) in oxaliplatin-resistant esophageal cancer and its knockdown enhanced drug sensitivity. (A) APOC1 expression was analyzed by Western blot in esophageal cancer (EC) tissues and adjacent normal tissues (n=5). (B) APOC1 expression was detected by Western blot in oxaliplatin (L-OHP)–resistant and L-OHP–sensitive EC tissues (n=5). (C) APOC1 expression was assessed by Western blot in normal esophageal epithelial cells (Het-1A) and EC cell lines (EC109, Kyse-30, Kyse-70, Kyse- 150, TE-1). (D) Cell viability was evaluated using a cell counting kit-8 (CCK-8) assay in EC cell lines after treatment with varying concentrations of L-OHP (0, 0.5, 1.0, 2.5, 5.0, and 10.0 μmol/L) for 48 hours to identify relatively L-OHP–resistant cell lines (2 lines were selected). *p < 0.05, **p < 0.01, and ***p < 0.001 for comparisons of EC109 vs. Kyse-30, Kyse-70, and Kyse-150, respectively; ##p < 0.01 and ###p < 0.001 for comparisons of TE-1 vs. Kyse-30, Kyse-70, and Kyse-150, respectively. (E) APOC1 expression was examined by Western blot in L-OHP–resistant EC109 and TE-1 cells and their parental counterparts. (F) Cell viability was measured using a CCK-8 assay in L-OHP–resistant EC109 and TE-1 cells and their parental counterparts after 48 hours of L-OHP treatment. (G) APOC1 expression was analyzed by Western blot in L-OHP–resistant EC109 and TE-1 cells with APOC1 knockdown (non-targeting control shRNA [shNC], shAPOC1). (H) Cell viability was determined using a CCK-8 assay in L-OHP–resistant EC109 and TE-1 cells with APOC1 knockdown (shNC, shAPOC1) after 48 hours of L-OHP treatment. Data are presented as mean±standard deviation. Unless specified otherwise, n=3. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 2. Transducin β-like 1 X-linked receptor 1 (TBL1XR1) and lysine methyltransferase 2E (KMT2E) transcriptionally regulated apolipoprotein C1 (APOC1) expression. (A) TBL1XR1 and KMT2E expression levels were assessed by Western blot in normal esophageal epithelial cells (Het-1A) and esophageal cancer (EC) cell lines (EC109, Kyse-30, Kyse-70, Kyse-150, TE-1). (B) TBL1XR1 and KMT2E expression levels were detected by Western blot in oxaliplatin (L-OHP)–resistant EC109 and TE-1 cells and their parental counterparts. (C) TBL1XR1 binding to the APOC1 promoter was predicted using hTFtarget. (D) TBL1XR1 binding to the APOC1 promoter was examined by chromatin immunoprecipitation (ChIP) assay in L-OHP–resistant EC109 and TE-1 cells. (E) TBL1XR1 and APOC1 expression levels were analyzed by Western blot in L-OHP–resistant EC109 and TE-1 cells with TBL1XR1 knockdown (non-targeting control shRNA [shNC], shTBL1XR1). (F) The binding of TBL1XR1 to the APOC1 promoter was evaluated by ChIP assay in L-OHP–resistant EC109 and TE-1 cells. (G) H3K4me3 modification at the APOC1 promoter was predicted using Cistrome DB. (H) H3K4me3 binding to the APOC1 promoter was detected by ChIP assay in L-OHP–resistant EC109 and TE-1 cells as well as their parent cells, EC109/p and TE-1/p. (I) KMT2E and APOC1 expression levels were determined by Western blot in L-OHP–resistant EC109 and TE-1 cells with KMT2E knockdown (shNC, shKMT2E). (J) KMT2E binding to the APOC1 promoter was assessed by ChIP assay in L-OHP–resistant EC109 and TE-1 cells. (K) KMT2E recruitment of H3K4me3 at the APOC1 promoter was investigated by ChIP-reChIP assay in L-OHP–resistant EC109 and TE-1 cells. (L) The interaction between TBL1XR1 and KMT2E was predicted using Biogrid4.4. (M) The interaction between TBL1XR1 and KMT2E was examined by co-immunoprecipitation assay in L-OHP–resistant EC109 and TE-1 cells. (N) The binding of TBL1XR1 and/or KMT2E to the APOC1 promoter was evaluated by ChIP in L-OHP–resistant EC109 and TE-1 cells. (O) KMT2E binding to the APOC1 promoter was detected by ChIP assay in L-OHP–resistant EC109 and TE-1 cells with TBL1XR1 knockdown (shNC, shTBL1XR1). (P) TBL1XR1 binding to the APOC1 promoter was detected by ChIP assay in L-OHP–resistant EC109 and TE-1 cells with KMT2E knockdown (shNC, shKMT2E). Data are presented as mean±standard deviation. n=3. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 3. Transducin β-like 1 X-linked receptor 1 (TBL1XR1) and lysine methyltransferase 2E (KMT2E) synergistically upregulated apolipoprotein C1 (APOC1) expression, promoting oxaliplatin (L-OHP) resistance in esophageal cancer. TBL1XR1 was knocked down and/or APOC1 was overexpressed in L-OHP–resistant EC109 and TE-1 cells. (A) TBL1XR1 and APOC1 expression levels were examined by Western blot. (B) Cell viability was assessed by cell counting kit-8 (CCK-8) assay following 48 hours of L-OHP treatment. KMT2E was knocked down and/or APOC1 was overexpressed in L-OHP–resistant EC109 and TE-1 cells. (C) Western blot analysis was performed to measure the expression levels of KMT2E and APOC1. (D) Cell viability was assessed using a CCK-8 assay after 48 hours of L-OHP treatment. Data are presented as mean±standard deviation (n=3). *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 4. Aly/REF export factor (ALYREF) was highly expressed in oxaliplatin (L-OHP)–resistant esophageal cancer tissues and cells, and its knockdown increased the sensitivity of esophageal cancer to L-OHP. (A) ALYREF expression levels were analyzed by Western blot in esophageal cancer (EC) tissues and adjacent normal tissues (n=5). (B) ALYREF expression levels were detected by Western blot in L-OHP–resistant and L-OHP–sensitive EC tissues (n=5). (C) ALYREF expression levels were assessed by Western blot in normal esophageal epithelial cells (Het-1A) and EC cell lines (EC109, Kyse-30, Kyse-70, Kyse-150, TE-1). (D) ALYREF expression levels were examined by Western blot in L-OHP–resistant EC109 and TE-1 cells and their parental counterparts. (E) ALYREF expression levels were analyzed by Western blot in L-OHP–resistant EC109 and TE-1 cells with ALYREF knockdown (non-targeting control shRNA [shNC], shALYREF). (F) Cell viability was assessed using a a cell counting kit-8 assay in L-OHP–resistant EC109 and TE-1 cells with ALYREF knockdown (shNC, shALYREF) after treatment with L-OHP (10.0 μmol/L) for 48 hours. Data are presented as mean±standard deviation. Unless specified otherwise, n=3. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 5. Aly/REF export factor (ALYREF) regulated the levels of transducin β-like 1 X-linked receptor 1 (TBL1XR1) and lysine methyltransferase 2E (KMT2E) through 5-methylcytosine (m5C) modification. Predicted binding of ALYREF to TBL1XR1 (A) and KMT2E (B) mRNA using RM2target. The binding of ALYREF to m5C sites on TBL1XR1 (C) and KMT2E (D) mRNA was assessed by dual-luciferase reporter assays in oxaliplatin (L-OHP)–resistant esophageal cancer (EC) cells with ALYREF knockdown (non-targeting control shRNA [shNC], shALYREF). Interaction of ALYREF with TBL1XR1 (E) and KMT2E (F) mRNA was detected using RNA immunoprecipitation assays in L-OHP–resistant EC cells with ALYREF knockdown (shNC, shALYREF). The binding of ALYREF to TBL1XR1 (G) and KMT2E (H) mRNA was further validated by RNA pulldown assays in L-OHP–resistant EC cells with ALYREF knockdown (shNC, shALYREF). FL, full-length; LY, cell lysate; NC, negative control (beads only). mRNA decay rates of TBL1XR1 (I) and KMT2E (J) were measured by quantitative real-time polymerase chain reaction in L-OHP–resistant EC cells with ALYREF knockdown (shNC, shALYREF) after treatment with actinomycin D. Data are presented as mean±standard deviation (n=3). *p < 0.05, **p < 0.01.

Fig. 6. Aly/REF export factor (ALYREF) promoted apolipoprotein C1 (APOC1) expression through transducin β-like 1 X-linked receptor 1 (TBL1XR1)/lysine methyltransferase 2E (KMT2E), thereby enhancing oxaliplatin (L-OHP) resistance in esophageal cancer. ALYREF was knocked down and/or TBL1XR1 was overexpressed in L-OHP–resistant EC109 and TE-1 cells. (A) ALYREF, TBL1XR1, and APOC1 expression levels were examined by Western blot. (B) Cell viability was assessed by a cell counting kit-8 (CCK-8) assay following 48 hours of L-OHP treatment. ALYREF was knocked down and/or KMT2E was overexpressed in L-OHP–resistant EC109 and TE-1 cells. (C) Western blot analysis was performed to measure the expression levels of ALYREF, KMT2E, and APOC1. (D) Cell viability was assessed using a CCK-8 assay after 48 hours of L-OHP treatment. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 7. Aly/REF export factor (ALYREF)–induced apolipoprotein C1 (APOC1)–mediated oxaliplatin (L-OHP) resistance in esophageal cancer via transducin β-like 1 X-linked receptor 1 (TBL1XR1)/lysine methyltransferase 2E (KMT2E) in vivo. L-OHP–resistant EC109 and TE-1 cells with ALYREF knockdown were subcutaneously injected into nude mice, followed by daily injections of oxaliplatin for 14 days. Tumor size (A), volume (B), and weight (C) were measured to assess tumor growth. (D) Expression levels of ALYREF, TBL1XR1, KMT2E, APOC1, and Ki67, as well as apoptosis assessed by TUNEL (termial deoxynucleotidyl transferase dUTP nick end labeling) were analyzed by immunohistochemistry in the tumor tissues of each group. Scale bars=50 μm. Data are presented as mean±standard deviation (n=6). *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Fig. 6.

Fig. 7.

ALYREF-Mediated Regulation of TBL1XR1 and KMT2E Synergistically Upregulates APOC1, Contributing to Oxaliplatin Resistance in Esophageal Cancer

Gene name	Sense sequence (5’-3’)	Anti-sense sequence (5’-3’)
ALYREF	AATTGCGTGGAGACAGGTGGGAAACTTCAAGAG-agtttcccacctgtctccacgTTTTTT	GATCAAAAAACGTGGAGACAGGTGGGAAACTCTCTTGA-agtttcccacctgtctccacgC
TBL1XR1	AATTGCCAGGGACTAATAATCCAAATTCAAGAG-atttggattattagtccctggTTTTTT	GATCAAAAAACCAGGGACTAATAATCCAAATCTCTTGA-atttggattattagtccctggC
KMT2E	AATTGGCTGTTCCCTTCCAGATTTAATCAAGAG-ttaaatctggaagggaacagcTTTTTT	GATCAAAAAAGCTGTTCCCTTCCAGATTTAACTCTTGA-ttaaatctggaagggaacagcC
APOC1	AATTGGACATTTCAGAAAGTGAAGGATCAAGAG-tccttcactttctgaaatgtcTTTTTT	GATCAAAAAAGACATTTCAGAAAGTGAAGGACTCTTGA tccttcactttctgaaatgtcC

Gene name	Forward sequence (5’-3’)	Reverse sequence (5’-3’)
TBL1XR1	GAGAACAGCACCAGTGGCTCTA	CCATCATAGGAACCAGTTGCTAG
KMT2E	CACAGATTGTCAGTGATGCTGAAG	CTGCTGTCCAATGTGAGTCCTAC
APOC1	AGGACAAGGCTCGGGAACTCAT	GATGTCACCCTTCAGGTCCTCA
GAPDH	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA

Table 1. The shRNA sequences were provided in the manuscript

Table 2. Primers used for RT-qPCR

RT-qPCR, quantitative real-time polymerase chain reaction.